Go Back to the CASRdb Home Page
CASRdb menu
Home:
 Click on CASRdb Logo
Search Mutations:
Geno/Phenotype Search
In Vitro Search
Author Search
Information Pages:
Mutations and polymorphisms in the CASR
Disease Clinical Pages (Royal Victoria Hospital)
Sequence of the CASR gene exons
GPCR Topology of the CASR
Position of Mutations in the CASR
Sequence and Features of the CASR
Contact Us

Dr. G.N.Hendy

Jacques Mao
Webmaster

We thank Drs. Lilia D'Souza-Li and Svetlana Pidasheva, and Ruth Milkereit and Yaroslava Chtompei for their previous help with the database. We thank Drs. Lucie Canaff, Vito Guarnieri and Yves Sabbagh for revising and maintaining the present database.

Calcium Sensing Receptor Database

DNA and protein sequence of the CASR

 E2
                                                                                                                                                                                                     5’UTR ¬
                                  CATCCCTTGCCCTGGAGAGACGGCAGAACC    -1
              ® START
1     ATG GCA TTT TAT AGC TGC TGC TGG GTC CTC TTG GCA CTC ACC TGG    45
1      M   A   F   Y   S   C   C   W   V   L   L   A   L   T   W     15

46    CAC ACC TCT GCC TAC GGG CCA GAC CAG CGA GCC CAA AAG AAG GGG    90
16     H   T   S   A   Y   G   P   D   Q   R   A   Q   K   K   G     30

91    GAC ATT ATC CTT GGG GGG CTC TTT CCT ATT CAT TTT GGA GTA GCA   135
31     D   I   I   L   G   G   L   F   P   I   H   F   G   V   A     45

136   GCT AAA GAT CAA GAT CTC AAA TCA AGG CCG GAG TCT GTG GAA TGT   180
46     A   K   D   Q   D   L   K   S   R   P   E   S   V   E   C     60

181    ATC AG gtaagaagaggggcctaa
61     I   R

  E3

186   tccag G TAT AAT TTC CGT GGG TTT CGC TGG TTA CAG GCT ATG ATA   225
62             Y   N   F   R   G   F   R   W   L   Q   A   M   I     75

226   TTT GCC ATA GAG GAG ATA AAC AGC AGC CCA GCC CTT CTT CCC AAC   270
76     F   A   I   E   E   I   N   S   S   P   A   L   L   P   N     90

271   TTG ACG CTG GGA TAC AGG ATA TTT GAC ACT TGC AAC ACC GTT TCT   315
91     L   T   L   G   Y   R   I   F   D   T   C   N   T   V   S    105

316   AAG GCC TTG GAA GCC ACC CTG AGT TTT GTT GCT CAA AAC AAA ATT   360
106    K   A   L   E   A   T   L   S   F   V   A   Q   N   K   I    120

361   GAT TCT TTG AAC CTT GAT GAG TTC TGC AAC TGC TCA GAG CAC ATT   405
121    D   S   L   N   L   D   E   F   C   N   C   S   E   H   I    135

406   CCC TCT ACG ATT GCT GTG GTG GGA GCA ACT GGC TCA GGC GTC TCC   450
136    P   S   T   I   A   V   V   G   A   T   G   S   G   V   S    150

451   ACG GCA GTG GCA AAT CTG CTG GGG CTC TTC TAC ATT CCC CAG gtactcaa
151    T   A   V   A   N   L   L   G   L   F   Y   I   P   Q        164
 

E4
 

                                                                     catgttcttggttctctccag  GTC   495
                                                                                                                                         V    165
496   AGT TAT GCC TCC TCC AGC AGA CTC CTC AGC AAC AAG AAT CAA TTC   540
166    S   Y   A   S   S   S   R   L   L   S   N   K   N   Q   F    180

541   AAG TCT TTC CTC CGA ACC ATC CCC AAT GAT GAG CAC CAG GCC ACT   585
181    K   S   F   L   R   T   I   P   N   D   E   H   Q   A   T    195

586   GCC ATG GCA GAC ATC ATC GAG TAT TTC CGC TGG AAC TGG GTG GGC   630
196    A   M   A   D   I   I   E   Y   F   R   W   N   W   V   G    210

631   ACA ATT GCA GCT GAT GAC GAC TAT GGG CGG CCG GGG ATT GAG AAA   675
211    T   I   A   A   D   D   D   Y   G   R   P   G   I   E   K    225

676   TTC CGA GAG GAA GCT GAG GAA AGG GAT ATC TGC ATC GAC TTC AGT   720
226    F   R   E   E   A   E   E   R   D   I   C   I   D   F   S    240

721   GAA CTC ATC TCC CAG TAC TCT GAT GAG GAA GAG ATC CAG CAT GTG   765
241    E   L   I   S   Q   Y   S   D   E   E   E   I   Q   H   V    255

766   GTA GAG GTG ATT CAA AAT TCC ACG GCC AAA GTC ATC GTG GTT TTC   810
256    V   E   V   I   Q   N   S   T   A   K   V   I   V   V   F    270

811   TCC AGT GGC CCA GAT CTT GAG CCC CTC ATC AAG GAG ATT GTC CGG   855
271    S   S   G   P   D   L   E   P   L   I   K   E   I   V   R    285

856   CGC AAT ATC ACG GGC AAG ATC TGG CTG GCC AGC GAG GCC TGG GCC   900
286    R   N   I   T   G   K   I   W   L   A   S   E   A   W   A    300

901   AGC TCC TCC CTG ATC GCC ATG CCT CAG TAC TTC CAC GTG GTT GGC   945
301    S   S   S   L   I   A   M   P   Q   Y   F   H   V   V   G    315

946   GGC ACC ATT GGA TTC GCT CTG AAG GCT GGG CAG ATC CCA GGC TTC   990
316    G   T   I   G   F   A   L   K   A   G   Q   I   P   G   F    330

991   CGG GAA TTC CTG AAG AAG GTC CAT CCC AGG AAG TCT GTC CAC AAT  1035
331    R   E   F   L   K   K   V   H   P   R   K   S   V   H   N    345

1036  GGT TTT GCC AAG GAG TTT TGG GAA GAA ACA TTT AAC TGC CAC CTC  1080
346    G   F   A   K   E   F   W   E   E   T   F   N   C   H   L    360

1081  CAA GAA GGT GCA AAA GGA CCT TTA CCT GTG GAC ACC TTT CTG AGA  1125
361    Q   E   G   A   K   G   P   L   P   V   D   T   F   L   R    375

1126  GGT CAC GAA GAA AGT GGC GAC AGG TTT AGC AAC AGC TCG ACA GCC  1170
376    G   H   E   E   S   G   D   R   F   S   N   S   S   T   A    390

1171  TTC CGA CCC CTC TGT ACA GGG GAT GAG AAC ATC AGC AGT GTC GAG  1215
391    F   R   P   L   C   T   G   D   E   N   I   S   S   V   E    405

1216  ACC CCT TAC ATA GAT TAC ACG CAT TTA CGG ATA TCC TAC AAT GTG  1260
406    T   P   Y   I   D   Y   T   H   L   R   I   S   Y   N   V    420

1261  TAC TTA GCA GTC TAC TCC ATT GCC CAC GCC TTG CAA GAT ATA TAT  1305
421    Y   L   A   V   Y   S   I   A   H   A   L   Q   D   I   Y    435

1306  ACC TGC TTA CCT GGG AGA GGG CTC TTC ACC AAT GGC TCC TGT GCA  1350
436    T   C   L   P   G   R   G   L   F   T   N   G   S   C   A    450

1351  GAC ATC AAG AAA GTT GAG GCG TGG CAG gtgcgtccttcacttatatagc   1377
451    D   I   K   K   V   E   A   W   Q                            459
 
 

 E5

1378                tcattctttgctcctctttag GTC CTG AAG CAC CTA CGG  1395
460                                       V   L   K   H   L   R    465

1396  CAT CTA AAC TTT ACA AAC AAT ATG GGG GAG CAG GTG ACC TTT GAT  1440
466    H   L   N   F   T   N   N   M   G   E   Q   V   T   F   D    480

1441  GAG TGT GGT GAC CTG GTG GGG AAC TAT TCC ATC ATC AAC TGG CAC  1485
481    E   C   G   D   L   V   G   N   Y   S   I   I   N   W   H    495

1486  CTC TCC CCA GAG GAT GGC TCC ATC GTG TTT AAG GAA GTC GGG TAT  1530
495    L   S   P   E   D   G   S   I   V   F   K   E   V   G   Y    510

1531  TAC AAC GTC TAT GCC AAG AAG GGA GAA AGA CTC TTC ATC AAC GAG  1575
511    Y   N   V   Y   A   K   K   G   E   R   L   F   I   N   E    525

1576  GAG AAA ATC CTG TGG AGT GGG TTC TCC AGG GAG gtaggtgctgtccat  1608
526    E   K   I   L   W   S   G   F   S   R   E                   536
 
 

E6

            (c)
      ccaaacttctccctcttacatgtttgaaggagacagtaggctggccccctgaccctacaacta
      cag CCA CTC ACC TTT GTG CTG TCT GTC CTC CAG
           P   L   T   F   V   L   S   V   L   Q
                            ®       alternative splice      ¬
1609                                              GTG CCC TTC TCC  1620
537                                               V   P   F   S    540

1621  AAC TGC AGC CGA GAC TGC CTG GCA GGG ACC AGG AAA GGG ATC ATT  1665
541    N   C   S   R   D   C   L   A   G   T   R   K   G   I   I    555

1666  GAG GGG GAG CCC ACC TGC TGC TTT GAG TGT GTG GAG TGT CCT GAT  1710
556    E   G   E   P   T   C   C   F   E   C   V   E   C   P   D    570

1711  GGG GAG TAT AGT GAT GAG ACA G gtaagggaac                     1732
571    G   E   Y   S   D   E   T                                    577
 
 

E7

1733              ctgggacattttacag AT GCC AGT GCC TGT AAC AAG TGC  1755
578                                D   A   S   A   C   N   K   C    585

1756  CCA GAT GAC TTC TGG TCC AAT GAG AAC CAC ACC TCC TGC ATT GCC  1800
586    P   D   D   F   W   S   N   E   N   H   T   S   C   I   A    600

1801  AAG GAG ATC GAG TTT CTG TCG TGG ACG GAG CCC TTT GGG ATC GCA  1845
601    K   E   I   E   F   L   S   W   T   E   F   F  G   I   A    615

1846  CTC ACC CTC TTT GCC GTG CTG GGC ATT TTC CTG ACA GCC TTT GTG  1890
616   L   T   L   F   A   V   L   G   I   F   L   T   A   F   V    630
                                  TM-1
1891  CTG GGT GTG TTT ATC AAG TTC CGC AAC ACA CCC ATT GTC AAG GCC  1935
631   L   G   V   F   I   K   F   R   N   T   P   I   V   K   A    645

1936  ACC AAC CGA GAG CTC TCC TAC CTC CTC CTC TTC TCC CTG CTC TGC  1980
646    T   N   R   E   L   S   Y   L   L   L   F   S   L   L   C    660
                                                 TM-2
1981  TGC TTC TCC AGC TCC CTG TTC TTC ATC GGG GAG CCC CAG GAC TGG  2025
661   C   F   S   S   S   L   F   F   I   G   E   P   Q   D   W    675

2026  ACG TGC CGC CTG CGC CAG CCG GCC TTT GGC ATC AGC TTC GTG CTC  2070
676    T   C   R   L   R   Q   P   A   F   G   I   S   F   V   L    690
                                                 TM-3
2071  TGC ATC TCA TGC ATC CTG GTG AAA ACC AAC CGT GTC CTC CTG GTG  2115
691   C   I   S   C   I   L   V   K   T   N   R   V   L   L   V    705

2116  TTT GAG GCC AAG ATC CCC ACC AGC TTC CAC CGC AAG TGG TGG GGG  2160
706    F   E   A   K   I   P   T   S   F   H   R   K   W   W   G    720

2161  CTC AAC CTG CAG TTC CTG CTG GTT TTC CTC TGC ACC TTC ATG CAG  2205
721    L   N   L   Q   F   L   L   V   F   L   C   T   F   M   Q    735
                                            TM-4
2206  ATT GTC ATC TGT GTG ATC TGG CTC TAC ACC GCG CCC CCC TCA AGC  2250
736   I   V   I   C   V   I   W   L   Y   T   A   P   P   S   S    750

2251  TAC CGC AAC CAG GAG CTG GAG GAT GAG ATC ATC TTC ATC ACG TGC  2295
751    Y   R   N   Q   E   L   E   D   E   I   I   F   I   T   C    765

2296  CAC GAG GGC TCC CTC ATG GCC CTG GGC TTC CTG ATC GGC TAC ACC  2340
766    H   E   G   S   L   M   A   L   G   F   L   I   G   Y   T    780
                                              TM-5
2341  TGC CTG CTG GCT GCC ATC TGC TTC TTC TTT GCC TTC AAG TCC CGG  2385
781   C   L   L   A   A   I   C   F   F   F   A   F   K   S   R    795

2386  AAG CTG CCG GAG AAC TTC AAT GAA GCC AAG TTC ATC ACC TTC AGC  2430
796    K   L   P   E   N   F   N   E   A   K   F   I   T   F   S    810

2431  ATG CTC ATC TTC TTC ATC GTC TGG ATC TCC TTC ATT CCA GCC TAT  2475
811   M   L   I   F   F   I   V   W   I   S   F   I   P   A   Y    825
     (A)                            TM-6
2476  GCC AGC ACC TAT GGC AAG TTT GTC TCT GCC GTA GAG GTG ATT GCC  2520
826   A(T) S   T   Y   G   K   F   V   S   A   V   E   V   I   A    840
                                                                                                               (A)
2521  ATC CTG GCA GCC AGC TTT GGC TTG CTG GCG TGC ATC TTC TTC AAC  2565
841   I   L   A   A   S   F   G   L   L   A  C(S) I   F   F   N    855
                               TM-7
2566  AAG ATC TAC ATC ATT CTC TTC AAG CCA TCC CGC AAC ACC ATC GAG  2610
856   K   I   Y   I   I   L   F   K   P   S   R   N   T   I   E    870

2611  GAG GTG CGT TGC AGC ACC GCA GCT CAC GCT TTC AAG GTG GCT GCC  2655
871    E   V   R   C   S   T   A   A   H   A   F   K   V   A   A    885

2656  CGG GCC ACG CTG CGC CGC AGC AAC GTC TCC CGC AAG CGG TCC AGC  2700
886    R   A   T   L   R   R   S   N   V   S   R   K   R   S   S    900

2701  AGC CTT GGA GGC TCC ACG GGA TCC ACC CCT TCC TCC TCC ATC AGC  2745
901    S   L   G   G   S   T   G   S   T   P   S   S   S   I   S    915

2746  AGC AAG AGC AAC AGC GAA GAC CCA TTC CCA CAG CCC GAG AGG CAG  2790
916    S   K   S   N   S   E   D   P   F   P   Q   P   E   R   Q    930

2791  AAG CAG CAG CAG CCG CTG GCC CTA ACC CAG CAA GAG CAG CAG CAG  2835
931    K   Q   Q   Q   P   L   A   L   T   Q   Q   E   Q   Q   Q    945

2836  CAG CCC CTG ACC CTC CCA CAG CAG CAA CGA TCT CAG CAG CAG CCC  2880
946    Q   P   L   T   L   P   Q   Q   Q   R   S   Q   Q   Q   P    960

2880  AGA TGC AAG CAG AAG GTC ATC TTT GGC AGC GGC ACG GTC ACC TTC  2925
961    R   C   K   Q   K   V   I   F   G   S   G   T   V   T   F    975
                                            (T)            (G)
2926  TCA CTG AGC TTT GAT GAG CCT CAG AAG AAC GCC ATG GCC CAC AGG  2970
976    S   L   S   F   D   E   P   Q   K   N  A(S) M   A   H  R(G)  990

2971  AAT TCT ACG CAC CAG AAC TCC CTG GAG GCC CAG AAA AGC AGC GAT  3015
991    N   S   T   H   Q   N   S   L   E   A   Q   K   S   S   D   1005
                        (G)
3016  ACG CTG ACC CGA CAC CAG CCA TTA CTC CCG CTG CAG TGC GGG GAA  3060
1006   T   L   T   R   H  Q(E) P   L   L   P   L   Q   C   G   E   1020

3061  ACG GAC TTA GAT CTG ACC GTC CAG GAA ACA GGT CTG CAA GGA CCT  3105
1021   T   D   L   D   L   T   V   Q   E   T   G   L   Q   G   P   1035

3106  GTG GGT GGA GAC CAG CGG CCA GAG GTG GAG GAC CCT GAA GAG TTG  3150
1036   V   G   G   D   Q   R   P   E   V   E   D   P   E   E   L   1050

3151  TCC CCA GCA CTT GTA GTG TCC AGT TCA CAG AGC TTT GTC ATC AGT  3195
1051   S   P   A   L   V   V   S   S   S   Q   S   F   V   I   S   1065

3195  GGT GGA GGC AGC ACT GTT ACA GAA AAC GTA GTG AAT TCA TAAAATG  3234
1066   G   G   G   S   T   V   T   E   N   V   V   N   S  STOP     1078
                                                     _ ¬ô® 3’UTR
 

Reference: Garrett, J. E., Capuano, I. V., Hammerland, L. G., Hung, B. C., Brown, E. M., Hebert, S. C., Nemeth, E. F., Fuller, F. 1995 Molecular
cloning and functional expression of human parathyroid calcium receptor cDNAs. J Biol Chem. 270: 12919?25  unique id: 95279439

Important Support
CIHR - Canadian Institutes of Health Research
The Canadian Genetic Diseases Network (CGDN-Network of Centers of Excellence)
Réseau de Médecine Génétique Appliquée (RMGA-FRSQ)
Robert McDonald Gift and Fund
Kidney Foundation of Canada
MRC of Canada (Group in Medical Genetics) (Historical)

43548 Hit(s)
Copyright © 2003 DeBelle - CASRdb